







Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by informational units in the mRNA called codons. Translation requires adapter molecules, the transfer RNAs, which recognize codons and insert amino acids into their appropriate sequential positions in the polypeptide.
The codons for the amino acids consist of specific nucleotide triplets. The base sequences of the codons were deduced from experiments using synthetic mRNAs of known composition and sequence. The genetic code is degenerate: it has multiple code words for nearly all the amino acids. The third position in each codon is much less specific than the first and second and is said to wobble. The standard genetic code words are probably universal in all species, although some minor deviations exist in mitochondria and a few single-celled organisms. The initiating amino acid, N-formylmethionine in bacteria, is coded by AUG. Recognition of a particular AUG as the initiation codon requires a purine-rich initiating signal (the Shine-Dalgarno sequence) on the 5' side of the AUG. The triplets UAA, UAG, and UGA do not code for amino acids but are signals for chain termination. In some viruses two different proteins may be coded by the same nucleotide sequence but translated with dif ferent reading frames.
Protein synthesis occurs on the ribosomes. Bacteria have 70S ribosomes, with a large (50S) subunit and a small (30S) subunit. Ribosomes of eukaryotes are significantly larger and contain more proteins than do bacterial ribosomes.
In stage 1 of protein synthesis, amino acids are activated by specific aminoacyl-tRNA synthetases in the cytosol. These enzymes catalyze the formation of aminoacyl-tRNAs, with simultaneous cleavage of ATP to AMP and PPi. The fidelity of protein synthesis depends to a large extent on the accuracy of this reaction, and some of these enzymes carry out proofreading steps at separate active sites. Transfer RNAs have 73 to 93 nucleotide units, several of which have modified bases. They have an amino acid arm with the terminal sequence CCA(3') to which an amino acid is esterified, an anticodon arm, a T?C arm, and a DHU arm; some tRNAs have a fifth or extra arm. The anticodon nucleotide triplet of tRNA is responsible for the specificity of interaction between the aminoacyltRNA and the complementary codon on the mRNA. The growth of polypeptide chains on ribosomes begins with the amino-terminal amino acid and proceeds by successive additions of new residues to the carboxyl-terminal end.
In bacteria, the initiating aminoacyl-tRNA in all proteins is N-formylmethionyl-tRNAfMet. Initiation of protein synthesis (stage 2) involves formation of a complex between the 30S ribosomal subunit, mRNA, GTP, fMet-tRNAfMet, two initiation factors, and the 50S subunit; GTP is hydrolyzed to GDP and Pi. In the subsequent elongation steps (stage 3), GTP and three elongation factors are required for binding the incoming aminoacyl-tRNA to the aminoacyl site on the ribosome. In the first peptidyl transfer reaction, the fMet residue is transferred to the amino group of the incoming aminoacyl-tRNA. Movement of the ribosome along the mRNA then translocates the dipeptidyl-tRNA from the aminoacyl site to the peptidyl site, a process requiring hydrolysis of GTP. After many such elongation cycles, synthesis of the polypeptide chain is terminated (stage 4) with the aid of release factors. A polysome consists of an mRNA molecule to which are attached several or many ribosomes, each independently reading the mRNA and forming a polypeptide. At least four high-energy phosphate bonds are required to generate each peptide bond, an energy investment required to guarantee fidelity of translation. In stage 5 of protein synthesis, polypeptides undergo folding into their active, three-dimensional forms. Many proteins also are further processed by posttranslational modification reactions.
After synthesis, many proteins are directed to particular locations in the cell. One targeting mechanism involves peptide signal sequences generally found at the amino terminus of newly synthesized proteins. In eukaryotes, one class of these signal sequences is recognized and bound by a large protein-RNA complex called the signal recognition particle (SRP). The SRP binds the signal sequence as soon as it appears on the ribosome and transfers the entire ribosome and incomplete polypeptide to the endoplasmic reticulum. Polypeptides with these signal sequences are moved into the lumen of the endoplasmic reticulum as they are synthesized; there they may be modified and moved to the Golgi complex, and then sorted and sent to lysosomes, the plasma membrane, or secretory vesicles. Other known targeting signals include carbohydrates (mannose-6-phosphate targets proteins to lysosomes) and three-dimensional structural features of the proteins called signal patches. Some proteins are imported into the cell by receptor-mediated endocytosis. These receptors are also used by some toxins and viruses to gain entry into cells.
Proteins are eventually degraded by specialized proteolytic systems present in all cells. Defective proteins and those slated for rapid turnover are generally degraded by an ATP-dependent proteolytic system. In eukaryotes, proteins to be broken down by this system are first tagged by linking them to a highly conserved protein called ubiquitin.
General
Hill, W.E., Dahlberg, A., Garrett, R.A., Moore, P.B., Schlessinger, D., & Warner, J.R. (1990) The Ribosome: Structure, Function, and Evolution, The American Society for Microbiology, Washington, DC.
Many good articles covering a wide range of topics.
Spirin, A.S. (1986) Ribosome Structure and Protein Biosynthesis, The Benjamin/Cummings Publishing Company, Menlo Park, CA.
The Genetic Code
Barrell, B.G., Air, G.M., & Hutchison, C.A., III (1976) Overlapping genes in bacteriophage ~X174. Nature 264, 34-41.
Crick, F.H.C. (1966) The genetic code: III. Sci. Am. 215 (October), 55-62.
An insightful overview of the genetic code at a time when the code words had just been worked out.
Fox, T.D. (1987) Natural variation in the genetic code. Annu. Rev. Genet. 21, 67-91.
Hatfield, D. & Oroszlan, S. (1990) The where, what and how of ribosomal frameshifting in retroviral protein synthesis. Trends Biochem. Sci. 15, 186-190.
Nirenberg, M.W. (1963) The genetic code: II. Sci. Am. 208 (March), 80-94.
A description of the original experiments.
Stuart, K. (1991) RNA editing in mitochondrial mRNA of trypanosomatids. Trends Biochem. Sci. 16, 68-72.
Weiner, A.M. & Maizels, N. (1990) RNA editing: guided but not templated? Cell 61, 917-920.
Protein Synthesis
Bjork, G.R., Ericson, J.U., Gustafsson, C.E.D., Hagervall, T.G., Jonsson, Y.H., & Wikstrom, P.M. (1987)'I~ansfer RNA modification. Annu. Rev. Biochem. 56, 263-288.
Burbaum, J.J. & Schimmel, P. (1991) Structural relationships and the classification of aminoacyltRNA synthetases. J. Biol. Chem. 266, 1696516968.
Chapeville, F., Lipmann, F., von Ehrenstein, G., Weisblum, B., Ray, W.J., Jr., & Benzer, S. (1962) On the role of soluble ribonucleic acid in coding for amino acids. Proc. Natl. Acad. Sci. USA 48, 10861092.
Classic experiments providing proof for Crick's adapter hypothesis and showing that amino acids are not checked after they are linked to tRNAs.
Clarke, S. (1992) Protein isoprenylation and methylation at carboxyl-terminal cysteine residues. Annu. Rev. Biochem. 61, 355-386.
Dahlberg, A.E. (1989) The functional role of ribosomal RNA in protein synthesis. Cell 57, 525-529.
Dintzis, H.M. (1961) Assembly of the peptide chains of hemoglobin. Proc. Natl. Acad. Sci. USA 47, 247-261.
A classic experdment establishing that proteins are assembled beginning at the amino terminus.
Fersht, A. (1985) Enzyme Structure and Mechan,ism, W.H. Freeman and Company, New York. See Chapter 13 for a discussion of proofreading in aminoacyl-tRNA synthetases.
Gualerzi, C.O. & Pon, C.L. (1990) Initiation of mRNA translation in prokaryotes. Biochemistry 29, 5881-5889.
Lake, J.A. (1981) The ribosome. Sci. Am. 245 (August), 84-97.
Maden, B.E.H. (1990) The numerous modified nucleotides in eukaryotic ribosomal RNA. Prog. Nucleic Acid Res. Mol. Biol. 39, 241-303.
Moldave, K. (1985) Eukaryotic protein synthesis. Annu. Rev.
Biochem. 54, 1109-1149.
Noller, H.F., Hoffarth, V., & Zimniak, L. (1992) Unusual
resistance of peptidyl transferase to protein extraction
procedures. Science 256, 1416-1419.
Normanly, J. & Abelson, J. (1989) tRNA identity. Annu. Rev. Biochem. 58, 1029-1049.
Rich, A. & Kim, S.H. (1978) The three-dimensional structure of transfer RNA. Sci. Am. 238, (January), 52-62.
Riis, B., Rattan, S.I.S., Clark, B.F.C., & Merrick, W.C. (1990) Eukaryotic protein elongation factors. Trends Biochem. Sci. 15, 420-424.
Schimmel, P. (1989) Parameters for the molecular recognition of transfer RNAs. Biochemistry 28, 2747-2759.
Bachmair, A., Finley, D., & Varshavsky, A. (1986) In vivo half life of a protein is a function of its amino-terminal residue. Science 234, 179-186.
Balch, W.E. (1989) Biochemistry of interorganelle transport: a new frontier in enzymology emerges from versatile in vitro model systems. J. Biol. Chem. 264, 16965-16968.
Dahms, N.M., Lobel, P., & Kornfeld, S. (1989) Mannose 6-phosphate receptors and lysosomal enzyme targeting. J. Biol. Chem. 264, 12115-12118.
Goldstein, J.L., Brown, M.S., Anderson, R.G.W., Russell, D.W., & Schneider, W.J. (1985) Receptormediated endocytosis: concepts emerging from the LDL receptor system. Annu. Rev. Cell Biol. 1, 1-39.
Hershko, A. & Ciechanover, A. (1992) The ubiquitin system for protein degradation. Annu. Reu. Biochem. 61, 761-807.
Hurt, E.C. & van Loon, A.P.G.M. (1986) How proteins find mitochondria and intramitochondrial compartments. Trends Biochem. Sci. 11, 204-207.
Mellman, I., Fuchs, R., & Helenius, A. (1986) Acidification of the endocytic and exocytic pathways. Annu. Reu. Biochem. 55, 663-700.
Meyer, D.I. (1988) Preprotein conformation: the year's major theme in translocation studies. Trends Biochem. Sci. 13, 471-474.
Pfeffer, S.R. & Rothman, J.E. (1987) Biosynthetic protein transport and sorting by the endoplasmic reticulum and Golgi. Annu. Reu. Biochem. 56, 829852.
Pryer, N.K., Wuestehube, L.J. & Schekman, R. (1992) Vesicle-mediated protein sorting. Annu. ReU. Biochem. 61, 471-516.
Randall, L.L. & Hardy, S.J.S. (1984) Export of protein in bacteria. Microbiol. Rev. 48, 290-298.
Rapoport, T.A. (1990) Protein transport across the ER membrane. Trends Biochem. ScL. 15, 355-358.
Rothman, J.E. (1985) The compartmental organization of the Golgi apparatus. Sci. Am. 253 (September), 74-89.
Schmidt, G.W. & Mishkind, M.L. (1986) The transport of proteins into chloroplasts. Annu. Rev. Biochem. 55, 879-912.
Silver, P.A. (1991) How proteins enter the nucleus. Cell 64, 489-497.
Ward, W.H.J. (1987) Diphtheria toxin: a novel cytocidal enzyme. ~ends Biochem. Sci. 12, 28-31.
Wickner, W.T. & Lodish, H.F. (1985) Multiple mechanisms of protein insertion into and across membranes. Science 230, 400-407.
1. Messenger RNA Translation Predict the amino acid sequences of peptides formed by ribosomes in response to the following mRNAs, assuming that the initial codon is the first three bases in each sequence.
(a)GGUCAGUCGCUCCUGAUU
(b)UUGGAUGCGCCAUAAUUUGCU
(c)CAUGAUGCCUGUUGCUAC
(d) AUGGACGAA
2. How Many mRNAs Can Specify One Amino Acid Sequence? Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea as to the number of possible mRNAs that can code for one polypeptide.
3. Can the Base Sequence of an mRNA Be Predicted from the Amino Acid Sequences of Its Polypeptide Product? A given sequence of bases in an mRNA will code for one and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From a given sequence of amino acid residues in a protein such as cytochrome c, can we predict the base sequence of the unique mRNA that coded for it? Give reasons for your answer.
4. Coding of a Polypeptide by Duplex DNA The template strand of a sample of double-helical DNA contains the sequence (5' )CTTAACACCCCTGACTTCGCGCCGTCG
(a) What is the base sequence of mRNA that can be transcribed from this strand?
(b) What amino acid sequence could be coded by the mRNA base sequence in (a), starting from the 5' end?
(c) Suppose the other (nontemplate) strand of this DNA sample is transcribed and translated. Will the
resulting amino acid sequence be the same as in (b)? Explain the biological significance of your answer.
5. Methionine Has Only One Codon Methionine is one of the two amino acids having only one codon. Yet the single codon for methionine can specify both the initiating residue and interior Met residues of polypeptides synthesized by E. coli. Explain exactly how this is possible.
6. Synthetic mRNAs How would you make a polyribonucleotide that could serve as an mRNA coding predominantly for many Phe residues and a small number of Leu and Ser residues? What other amino acid(s) would be coded for by this polyribonucleotide but in smaller amounts?
7. The Direct Energy Cost of Protein Biosynthesis Determine the minimum energy cost, in terms of high-energy phosphate groups expended, required for the biosynthesis of the ß-globin chain of hemoglobin (146 residues), starting from a pool including all necessary amino acids, ATP, and GTP. Compare your answer with the direct energy cost of the biosynthesis of a linear glycogen chain of 146 glucose residues in (a1?4) linkage, starting from a pool including glucose, UTP, and ATP (Chapter 19). From your data, what is the extra energy cost of imparting the genetic information inherent in the ß-globin molecule?
8. Indirect Costs of Protein Synthesis In addition to the direct energy cost for the synthesis of a protein, as developed in Problem 7, there are indirect energy costs-those required for the cell to make the necessary biocatalysts for protein synthesis. Contrast the relative magnitude of the indirect costs to a eukaryotic cell of the biosynthesis of linear (ah4) glycogen chains versus the indirect costs of the biosynthesis of polypeptides. (Compare the enzymatic machinery used to synthesize proteins and glycogen.)
9. Predicting Anticodons from Codons Most amino acids have more than one codon and will be attached to more than one tRNA, each with a dif ferent anticodon. Write all possible anticodons for the four codons for glycine: (5')GGU, GGC, GGA, and GGG.
(a) From your answer, which of the positions in the anticodons are primary determinants of their codon specificity in the case of glycine?
(b) Which of these anticodon-codon pairings have a wobbly base pair?
(c) In which of the anticodon-codon pairings do all three positions exhibit strong Watson-Crick hydrogen bonding?
10. The Effect of Single-Base Changes on Amino Acid Sequence Much important confirmatory evidence on the genetic code has come from the nature of single-residue changes in the amino acid sequence of mutant proteins. Which of the following single-residue amino acid replacements would be consistent with the genetic code? Which cannot be the result of single-base mutations? Why?
(a) Phe → Leu
(b) Lys → Ala
(c) Ala → Thr
(d) Phe → Lys
(e) Ile → Leu
(f) His → Glu
(g) Pro → Ser
11. The Basis of the Sickle-Cell Mutation In sicklecell hemoglobin there is a Val residue at position 6 of the ,β-globin chain, instead of the Glu residue found in this position in normal hemoglobin A. Can you predict what change took place in the DNA codon for glutamate to account for its replacement by valine?
12. Importance of the "Second Genetic Code" Some aminoacyl-tRNA synthetases do not bind the anticodon of their cognate tRNAs but instead use other structural features of the tRNAs to impart binding specificity. The tRNAs for alanine apparently fall into this category. Describe the consequences of a C→G mutation in the third position of the anticodon of tRNAAla. What other kinds of mutations might have similar eff'ects? Mutations of these kinds are never found in natural populations of any organism. Why? (Hint: Consider what might happen both to individual proteins and to the organism as a whole. )
13. Maintaining the Fidelity of Protein Synthesis The chemical mechanisms used to avoid errors in protein synthesis are different from those used during DNA replication. DNA polymerases utilize a 3'→5' exonuclease proofreading activity to remove mispaired nucleotides incorrectly inserted into a growing DNA strand. There is no analogous proofreading function on ribosomes; and, in fact, the identity of amino acids attached to incoming tRNAs and added to the growing polypeptide is never checked. A proofreading step that hydrolyzed the last peptide bond formed when an incorrect amino acid was inserted into a growing polypeptide (analogous to the proofreading step of DNA polymerases) would actually be chemically impractical. Why? (Hint: Consider how the link between the growing polypeptide and the mRNA is maintained during the elongation phase of protein synthesis; see Figs. 26-27 and 26-28.)







